Review



sequence 179847 to 179814  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    ATCC sequence 179847 to 179814
    Sequence 179847 To 179814, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sequence+179847+to+179814/Acinetobacter+sp%2E+genomospecies+9/us08980604-288-61-68
    Average 93 stars, based on 12 article reviews
    sequence 179847 to 179814 - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Mutant glycerol dehydrogenase (GlyDH) for the production of a biochemical by fermentation
    Article Snippet: The 100-base pair product was subcloned into NcoI/HindIII digested plasmid pME101 to generate pME101VB01. pME101VB01 1, consisting of 100 bases (SEQ ID NO 11): catgggctagctacgtattaattaaagatctcctagggagctcaccggt TAAAAATAAGAGTTACCTTAAATGGTAACTCTTATTTTTTTAggcgcgc ca pME101VB01 2, consisting of 100 bases (SEQ ID NO 12): agcttggcgcgccTAAAAAAATAAGAGTTACCATTTAAGGTAACTCTTA TTTTTAaccggtgagctccctaggagatctttaattaatacgtagctag cc with: a region (underlined lower-case letters) corresponding to the multicloning site a region (upper-case letters) corresponding to the adc transcription terminator (sequence 179847 to 179814) of Clostridium acetobutylicum ATCC 824 pSOL1 (NC—001988).

    Sequencing:

    Article Title: Mutant glycerol dehydrogenase (GlyDH) for the production of a biochemical by fermentation
    Article Snippet: The 100-base pair product was subcloned into NcoI/HindIII digested plasmid pME101 to generate pME101VB01. pME101VB01 1, consisting of 100 bases (SEQ ID NO 11): catgggctagctacgtattaattaaagatctcctagggagctcaccggt TAAAAATAAGAGTTACCTTAAATGGTAACTCTTATTTTTTTAggcgcgc ca pME101VB01 2, consisting of 100 bases (SEQ ID NO 12): agcttggcgcgccTAAAAAAATAAGAGTTACCATTTAAGGTAACTCTTA TTTTTAaccggtgagctccctaggagatctttaattaatacgtagctag cc with: a region (underlined lower-case letters) corresponding to the multicloning site a region (upper-case letters) corresponding to the adc transcription terminator (sequence 179847 to 179814) of Clostridium acetobutylicum ATCC 824 pSOL1 (NC—001988).



    Similar Products

    sequence 179847 to 179814  (ATCC)
    93
    ATCC sequence 179847 to 179814
    Sequence 179847 To 179814, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sequence+179847+to+179814/Acinetobacter+sp%2E+genomospecies+9/us08980604-288-61-68
    Average 93 stars, based on 1 article reviews
    sequence 179847 to 179814 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier

    Image Search Results